How to Upload Dv Sessions to Proycon
Appl Environ Microbiol. 2017 May 1; 83(9): e00211-17.
Published online 2017 Apr 17. Prepublished online 2017 Mar three. doi:10.1128/AEM.00211-17
Prevalence, Genotype Richness, and Coinfection Patterns of Hemotropic Mycoplasmas in Raccoons (Procyon lotor) on Environmentally Protected and Urbanized Barrier Islands
Dmitriy Five. Volokhov
aCenter for Biologics Evaluation and Research, Food and Drug Administration, Silver Spring, Maryland, U.s.
Jusun Hwang
bDepartment of Veterinarian Pathology, University of Georgia, Athens, Georgia, USA
Vladimir E. Chizhikov
aEye for Biologics Evaluation and Research, Food and Drug Administration, Silver Spring, Maryland, The states
Heather Danaceau
cCollege of Veterinarian Medicine, University of Georgia, Athens, Georgia, United states of america
Nicole Fifty. Gottdenker
bSection of Veterinary Pathology, University of Georgia, Athens, Georgia, U.s.
Charles M. Dozois, Editor
Charles Chiliad. Dozois, INRS-Institut Armand-Frappier;
Received 2017 Jan 24; Accepted 2017 Feb 22.
- Supplementary Materials
-
Supplemental material
GUID: DB09CCA9-646C-4BB8-B642-F8C4F1611833
GUID: 28C3317A-1718-4344-ABC5-30A09A6E68D2
GUID: B9563B5E-C484-41AF-AEB1-F3F805904FFB
GUID: D1A48D47-6F02-4232-B365-CE4A8B036C65
Abstruse
Raccoons (Procyon lotor) are successful urban adapters and hosts to a number of zoonotic and nonzoonotic pathogens, notwithstanding little is known about their hemoplasma infections and how prevalence varies across habitat types. This report identifies hemotropic Mycoplasma species infection in raccoons from urban and undisturbed habitats and compares hemoplasma infection in sympatric urban cats (Felis catus) from the same geographic region. Nosotros collected claret from raccoons (n = 95) on an urban coastal island (n = 37) and an undisturbed coastal isle (due north = 58) and from sympatric urban cats (n = 39) in Georgia, USA. Based on 16S rRNA factor amplification, 62.1% (59/95) of raccoons and 17.9% (7/39) of feral cats were positive for hemoplasma. There was a greater percentage of hemoplasma-infected raccoons on the undisturbed island (79.3% [46/58]) than on the urban isle (35.1% [thirteen/37]; χ2 = 16.9, df = ane, P = 0.00004). Sequencing of the total-length 16S rRNA cistron amplicons revealed six hemoplasma genotypes in raccoons, including 5 novel genotypes that were singled-out from 3 known hemoplasma species identified in the sympatric cats. In addition, the hemoplasma genotypes detected in raccoons were not identified in sympatric cats or vice versa. Although all 6 hemoplasma genotypes were establish in raccoons from urban and undisturbed islands, coinfection patterns differed betwixt sites and amid individuals, with the proportion of coinfected raccoons beingness greater in the undisturbed site. This written report shows that raccoons are hosts for several novel hemoplasmas and that habitat type influences infection patterns.
IMPORTANCE This written report provides information about novel hemoplasmas identified in raccoons (Procyon lotor), which can be used for assessments of the prevalence of these hemoplasmas in raccoon populations and for future studies on the potential pathogenic impacts of these hemoplasmas on raccoon health. Raccoons from the undisturbed habitat had a higher prevalence of hemoplasma infection than urban raccoons. There does not appear to exist cantankerous-species transmission of hemotropic mycoplasmas between urban raccoons and feral cats. Raccoons announced to be hosts for several novel hemoplasmas, and habitat type influences infection patterns.
KEYWORDS: raccoons, Procyon lotor, feral cats, Felis catus, hemoplasmas, wildlife, 16S rRNA gene, phylogenetic analysis, hemoplasma
INTRODUCTION
Urbanization is a potent ecological driver that causes significant changes in the composition of wild animals communities and in various intra- and interspecies interactions (1). Ecological responses to urbanization can lead to changes in the dynamics of wild fauna-parasite interactions and in patterns of pathogen transmission through mechanisms such as loss of species variety, changes in vector abundance, and increased exposure to invasive species and their pathogens (2). Urban-adapted wildlife frequently share anthropogenic nutrient sources with other species and can live in close proximity to other wild and feral/domestic animals (iii). Resource use overlap in urbanized environments tin increase direct and indirect contact within species and facilitate cross-species transmission of pathogens between wildlife and animals, such as feral cats, while providing opportunities for pathogens to adjust to novel host species and expand their host range (2, 4, 5). In improver, smaller domicile range sizes, increased aggregation, and loftier population densities of some wild animals in urban areas (3) can further increase opportunities for contact betwixt species and potentially increment cross-species pathogen transmission.
The raccoon (Procyon lotor) is well known for its adaptability to urbanized habitats and active interaction with domestic animals, such equally cats and dogs (6). In urbanized habitats, raccoons and feral cats (Felis catus) are often highly arable, ofttimes foraging in close proximity to one another on clumped anthropogenic food sources (due east.g., garbage and intentional feeding). Raccoons too harbor diverse pathogens shared with or transmitted to other domestic and/or wild animals, such as canine distemper virus, parvovirus, rabies virus, and Leptospira (half dozen). Here, we used raccoons from urban and undisturbed environments and urban feral cats every bit a study organization to compare and investigate hemotropic Mycoplasma species (so-called genotypes hither) composition, richness, coinfection patterns, and potential cross-species transmission.
Hemoplasmas (the common proper name for hemotropic Mycoplasma species) are facultative intracellular erythrocytic parasites without a cell wall comprising a grouping of noncultivable Mycoplasma species, including organisms formerly known equally Haemobartonella and Eperythrozoon species, which were reclassified as Mycoplasma species based on phylogenetic assay of their 16S rRNA cistron sequences and deeper studies on cell morphological properties (7,–xi). Hemoplasmas are causative agents of acute or chronic infectious anemias in several mammalian species (7, 12, 13). Human infections with hemotropic mycoplasmas and potential zoonotic transmission of these organisms have too been reported (14,–16). Animal infection with hemotropic mycoplasmas is normally self-limiting and well controlled by immunocompetent animals; however, the establishment of clinically inapparent chronic bacteremia is possible in stressed, immunosuppressed, immunocompromised, and immunocompetent individuals (7, xiv, 17). The chief hematological observation in hemoplasma-infected animals is mild or astringent anemia and positive Coombs tests, only infections can occur with or without alterations in hematological parameters (xiii, 18). The intracellular life cycle of some hemotropic mycoplasmas may explicate the chronicity of hemotropic mycoplasma infections in their natural hosts (nineteen).
Several hemoplasma species have been reported from wild carnivores, including Darwin's foxes (Lycalopex fulvipes), blackness bears (Ursus thibetanus japonicus), Namibian cheetahs (Acinonyx jubatus), Iriomote cats (Prionailurus bengalensis iriomotensis), California sea lions (Zalophus californianus), Japanese badgers (Meles anakuma), raccoon dogs (Nyctereutes procyonoides viverrinus), and Asian mongooses (Herpestes javanicus) (eighteen, xx,–25). However, mycoplasma (including hemoplasma) infections of raccoons (Procyon lotor) are poorly studied (26). In 1971, Haemobartonella procyoni was described in raccoons from Maryland, United states of america (27). The morphology of the parasite resembled that of Mycoplasma haemomuris (formerly Haemobartonella muris), and the microorganism was found in association with the surface of host erythrocytes. The naturally infected raccoons did non have any clinical signs or hematological abnormalities, although infection prevalence was approximately 50%, and parasitemia persisted for 60 days of ascertainment (27).
The objectives of this report were (i) to place hemotropic mycoplasmas in raccoons and compare infection prevalence, genotype richness, and coinfection patterns in raccoons on an urban and an undisturbed barrier isle, and (ii) to evaluate the possibility of cross-species manual of hemoplasmas between urban raccoons and sympatric feral cats.
RESULTS
PCR amplification of hemoplasma sequences from claret samples.
Master screening using the HBT-F and HBT-R primers for distension of the 16S rRNA factor sequences demonstrated that 62.1% (59/95) of raccoons were PCR positive for hemoplasma Deoxyribonucleic acid. These previously published universal primers amplified the partial 16S rRNA gene of Mycoplasma spp. and were successfully used for differentiating hemoplasma-positive and hemoplasma-negative animals. In 2012, the International Committee on Systematics of Prokaryotes (ICSP) subcommittee on the taxonomy of Mollicutes agreed the recommendation to require the full-length 16S rRNA gene sequences in papers describing new hemoplasmas (28). Based on this recommendation, nosotros generated the total-length 16S rRNA gene sequences and used them for construction of our phylogenetic trees. To amplify of the full-length 16S rRNA genes of hemoplasmas nowadays in blood samples of raccoons and cats, we designed new primers based on available sequences in GenBank (run across Materials and Methods). Using these new primers for viii individual 16S rRNA-based PCRs (16S-PCR-1 through 16S-PCR-8), we successfully amplified the individual full-length rRNA genes of each hemoplasma nowadays in the raccoon blood DNA samples (Tabular array 1). V of these viii primer pairs produced the full-length 16S rRNA amplicons from hemoplasma-positive raccoons (16S-PCR sets 1, 2, 3, 5, and 8 [Tabular array ane]). In contrast, only three primer pairs amplified the full-length 16S rRNA amplicons from hemoplasma-positive cats (16S-PCR sets 5 to 7), i.e., the primers designed for Mycoplasma haemofelis, "Candidatus Mycoplasma turicensis," and "Candidatus Mycoplasma haemominutum," respectively. The 16S primer pairs 6 and 7 did non generate any amplicons from hemoplasma-positive raccoons. The 16S primer pair 5, which was designed to amplify the full-length 16S rRNA genes of both Grand. haemofelis and Mycoplasma haemocanis, was the only set that worked with both raccoons and cats. The 16S primer pair four, which was designed to amplify the total-length 16S rRNA factor of Mycoplasma suis, did not generate whatever amplicons from either raccoons or cats.
Table one
Hemotropic mycoplasmas detected in raccoons
| GenBank accession no. a | Sample ID | Hemoplasma genotype detected in raccoons | Primer set used for full-length 16S rRNA distension (see Tabular array S1) | Sequence homology to other hemoplasmas (GenBank accession no.) |
|---|---|---|---|---|
| {"type":"entrez-nucleotide","attrs":{"text":"KC920443","term_id":"509315499","term_text":"KC920443"}}KC920443 | PRLO50 | iii | 16S-PCR-1 | 96% to "Candidatus Mycoplasma erythrodidelphis" ({"type":"entrez-nucleotide","attrs":{"text":"AF178676","term_id":"6708130","term_text":"AF178676"}}AF178676) |
| {"type":"entrez-nucleotide","attrs":{"text":"KC920441","term_id":"509315497","term_text":"KC920441"}}KC920441 | PRLO49 | |||
| {"blazon":"entrez-nucleotide","attrs":{"text":"KC920447","term_id":"509315503","term_text":"KC920447"}}KC920447 | PRLO72 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KC920446","term_id":"509315502","term_text":"KC920446"}}KC920446 | PRLO84 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KC920445","term_id":"509315501","term_text":"KC920445"}}KC920445 | PRLO62 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KC920444","term_id":"509315500","term_text":"KC920444"}}KC920444 | PRLO57 | |||
| {"blazon":"entrez-nucleotide","attrs":{"text":"KC920442","term_id":"509315498","term_text":"KC920442"}}KC920442 | PRLO42 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KC920448","term_id":"509315504","term_text":"KC920448"}}KC920448 | PRLO53 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KC920440","term_id":"509315496","term_text":"KC920440"}}KC920440 | PRLO25 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KC920439","term_id":"509315495","term_text":"KC920439"}}KC920439 | PRLO96 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743729","term_id":"568603892","term_text":"KF743729"}}KF743729 | PRLO102 | two | 16S-PCR-iii | 92–93% to "Candidatus Mycoplasma haemozalophi" ({"type":"entrez-nucleotide","attrs":{"text":"GU905012","term_id":"294768453","term_text":"GU905012"}}GU905012) and "Candidatus Mycoplasma haemolamae" ({"blazon":"entrez-nucleotide","attrs":{"text":"AF306346","term_id":"11120558","term_text":"AF306346"}}AF306346) |
| {"type":"entrez-nucleotide","attrs":{"text":"KF743724","term_id":"568603887","term_text":"KF743724"}}KF743724 | PRLO88 | |||
| {"blazon":"entrez-nucleotide","attrs":{"text":"KF743727","term_id":"568603890","term_text":"KF743727"}}KF743727 | PRLO92 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743722","term_id":"568603885","term_text":"KF743722"}}KF743722 | PRLO86 | |||
| {"blazon":"entrez-nucleotide","attrs":{"text":"KF743713","term_id":"568603876","term_text":"KF743713"}}KF743713 | PRLO56 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KC936280","term_id":"507579703","term_text":"KC936280"}}KC936280 | PRLO87 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743717","term_id":"568603880","term_text":"KF743717"}}KF743717 | PRLO65 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743726","term_id":"568603889","term_text":"KF743726"}}KF743726 | PRLO91 | 4 | 16S-PCR-2 | 86–88% to raccoon hemoplasma genotypes 2 and 3, and to "Candidatus Mycoplasma haemominutum," M. wenyonii, and M. ovis |
| {"type":"entrez-nucleotide","attrs":{"text":"KF743711","term_id":"568603874","term_text":"KF743711"}}KF743711 | PRLO46 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743728","term_id":"568603891","term_text":"KF743728"}}KF743728 | PRLO101 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743721","term_id":"568603884","term_text":"KF743721"}}KF743721 | PRLO84 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743719","term_id":"568603882","term_text":"KF743719"}}KF743719 | PRLO77 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743718","term_id":"568603881","term_text":"KF743718"}}KF743718 | PRLO74 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743716","term_id":"568603879","term_text":"KF743716"}}KF743716 | PRLO64 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743706","term_id":"568603869","term_text":"KF743706"}}KF743706 | PRLO24 | 5 | 16S-PCR-v | 96–97% to Chiliad. haemocanis ({"blazon":"entrez-nucleotide","attrs":{"text":"AY529641","term_id":"42566491","term_text":"AY529641"}}AY529641) (including M. haemocanis detected in Japanese raccoon dog [{"type":"entrez-nucleotide","attrs":{"text":"AB848714","term_id":"537685873","term_text":"AB848714"}}AB848714] and G. haemocanis/M. haemofelis-like sp. detected in Japanese black conduct [{"blazon":"entrez-nucleotide","attrs":{"text":"AB725596","term_id":"390979526","term_text":"AB725596"}}AB725596]), to G. haemofelis ({"type":"entrez-nucleotide","attrs":{"text":"AF548631","term_id":"24415969","term_text":"AF548631"}}AF548631), and to raccoon hemoplasma genotype 1 |
| {"blazon":"entrez-nucleotide","attrs":{"text":"KF743734","term_id":"568603897","term_text":"KF743734"}}KF743734 | PRLO_56HC | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743715","term_id":"568603878","term_text":"KF743715"}}KF743715 | PRLO62 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743736","term_id":"568603899","term_text":"KF743736"}}KF743736 | PRLO_103HC | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743704","term_id":"568603867","term_text":"KF743704"}}KF743704 | PRLO14 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743710","term_id":"568603873","term_text":"KF743710"}}KF743710 | PRLO44 | 6 | 16S-PCR-8 | 91–92% to raccoon hemoplasma genotype five, and to "Candidatus Mycoplasma haemobos" ({"type":"entrez-nucleotide","attrs":{"text":"EF460765","term_id":"134285134","term_text":"EF460765"}}EF460765) |
| {"blazon":"entrez-nucleotide","attrs":{"text":"KF743733","term_id":"568603896","term_text":"KF743733"}}KF743733 | PRLO_55HB | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743707","term_id":"568603870","term_text":"KF743707"}}KF743707 | PRLO33 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743731","term_id":"568603894","term_text":"KF743731"}}KF743731 | PRLO104 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743720","term_id":"568603883","term_text":"KF743720"}}KF743720 | PRLO80 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743714","term_id":"568603877","term_text":"KF743714"}}KF743714 | PRLO59 | one (K. haemocanis/M. haemofelis-similar sp.) | 16S-PCR-v | 99% to Thou. haemocanis ({"type":"entrez-nucleotide","attrs":{"text":"AY529641","term_id":"42566491","term_text":"AY529641"}}AY529641) and 1000. haemofelis ({"type":"entrez-nucleotide","attrs":{"text":"AF548631","term_id":"24415969","term_text":"AF548631"}}AF548631) |
| {"blazon":"entrez-nucleotide","attrs":{"text":"KF743709","term_id":"568603872","term_text":"KF743709"}}KF743709 | PRLO40 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743723","term_id":"568603886","term_text":"KF743723"}}KF743723 | PRLO87 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743735","term_id":"568603898","term_text":"KF743735"}}KF743735 | PRLO_92HC | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743732","term_id":"568603895","term_text":"KF743732"}}KF743732 | PRLO_43SC | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743705","term_id":"568603868","term_text":"KF743705"}}KF743705 | PRLO21 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743712","term_id":"568603875","term_text":"KF743712"}}KF743712 | PRLO55 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743725","term_id":"568603888","term_text":"KF743725"}}KF743725 | PRLO90 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743708","term_id":"568603871","term_text":"KF743708"}}KF743708 | PRLO38 | |||
| {"type":"entrez-nucleotide","attrs":{"text":"KF743730","term_id":"568603893","term_text":"KF743730"}}KF743730 | PRLO103 |
Based on our total-length 16S rRNA PCR analyses, only 54.7% of raccoons (versus 62.1% with the HBT-F and HBT-R primers) were hemoplasma positive. The difference (54.vii% versus 62.1%) betwixt our new primers and HBT-F/R primers tin can be attributed to (i) the difference in the length of amplicons (1,400 to 1,460 bp versus 595 to 620 bp, respectively), (ii) the possible difference in hemoplasma Deoxyribonucleic acid load in claret amongst the raccoons, which could impact the efficiency of distension of the full-length 16S rRNA sequences, (iii) the degree of optimization of our PCR weather condition for these new primers, and/or (iv) a combination of these factors.
Half-dozen hemotropic mycoplasma sequences (genotypes) with fractional identity with the 16S rRNA gene sequences of known hemoplasma sequences (available in GenBank) were detected in raccoon populations (Tabular array 1; run into also Tabular array S2 in the supplemental material). Except for ii M. haemocanis/1000. haemofelis-similar raccoon hemoplasmas (called raccoon hemoplasma genotypes ane and v), which had 96 to 97% nucleotide sequence identity with each other in their 16S rRNA genes, the other hemoplasma sequences (genotypes 2 to 4 and 6) detected in raccoons demonstrated lower levels of genetic similarity (≤86 to 96%) among these genotypes and to other known hemoplasma species (Tables 1 and S2).
Raccoon hemoplasma genotypes 1 and 5 were amplified from independent raccoon claret samples using the primers designed to amplify the total-length 16S rRNA factor of K. haemocanis/M. haemofelis. Genotype v (GenBank accession no. {"blazon":"entrez-nucleotide","attrs":{"text":"KF743706","term_id":"568603869","term_text":"KF743706"}}KF743706) had just 96 to 97% nucleotide sequence identity with Grand. haemocanis/M. haemofelis and genotype 1, whereas genotype ane (GenBank accretion no. {"type":"entrez-nucleotide","attrs":{"text":"KF743705","term_id":"568603868","term_text":"KF743705"}}KF743705) had 99% nucleotide similarity to Thou. haemocanis/M. haemofelis (Tables 1 and S2). When amplification from the rpoB and gyrB genes was attempted on all the raccoon samples positive for these 2 M. haemocanis/1000. haemofelis-like hemoplasma genotypes (PCR-A to -D primer sets for rpoB [PCR-A to -C] and PCR-D set for gyrB [Table S1]), distension from the rpoB gene was unsuccessful for both genotypes of One thousand. haemocanis/K. haemofelis-like raccoon hemoplasmas, and amplification from the gyrB cistron was possible only for genotype 1 and not for genotype 5. Sequence analysis of the amplified gyrB genes (GenBank accretion no. {"blazon":"entrez-nucleotide","attrs":{"text":"KF743740","term_id":"568603903","term_text":"KF743740"}}KF743740 to {"type":"entrez-nucleotide","attrs":{"text":"KF743744","term_id":"568603911","term_text":"KF743744"}}KF743744) and their deduced protein sequences demonstrated low identity (73 to 75% nucleotide and 87 to 88% amino acid) with both One thousand. haemocanis and M. haemofelis. Thus, these Thousand. haemocanis/G. haemofelis-similar spp. (genotypes 1 and 5) detected in raccoon blood samples were unlikely to belong to the known species M. haemocanis or M. haemofelis only were closely related to them phylogenetically. All attempts to amplify rpoB cistron sequences from the other raccoon hemoplasma-positive samples using previously published primers designed for rpoB of Mycoplasma spp. (29) failed to yield amplicons.
In feral cats on St. Simons island, G. haemofelis (north = 1), "Ca. Mycoplasma haemominutum" (n = v), and "Ca. Mycoplasma turicensis" (n = i) were identified by the full-length 16S rRNA gene amplification and sequencing; all the same, these species were not detected in raccoons. The presence of M. haemofelis and "Ca. Mycoplasma haemominutum" in cat blood was also confirmed by amplification and sequencing of their fractional rpoB genes (GenBank accession no. {"type":"entrez-nucleotide","attrs":{"text":"KF743746","term_id":"568603915","term_text":"KF743746"}}KF743746 to {"type":"entrez-nucleotide","attrs":{"text":"KF743751","term_id":"568603925","term_text":"KF743751"}}KF743751).
Phylogenetic analysis of the 16S rRNA genes.
We used sequences of the 16S rRNA genes to determine the phylogenetic relatedness of the hemoplasmas (genotypes) detected in raccoons with those of other known hemotropic Mycoplasma species available in GenBank (Fig. 1). No chimeras were detected from all 16S rRNA gene sequences generated in this written report. The dendrogram in Fig. 1 shows the inferred phylogenetic position of the hemoplasma sequences identified in raccoons among known hemotropic Mycoplasma species. The interspecies similarity of the 16S rRNA genes among the species in the phylogenetic tree was also assessed (Table S2). The 16S rRNA-based phylogenetic analysis and the interspecies similarity information showed that the raccoon hemoplasma genotypes were phylogenetically related to known hemoplasma species, i.e., M. haemocanis, 1000. haemofelis, "Candidatus Mycoplasma haemobos," "Candidatus Mycoplasma wenyonii," Mycoplasma ovis, "Candidatus Mycoplasma haemocervae," "Candidatus Mycoplasma erythrocervae," "Candidatus Mycoplasma erythrodidelphis," "Candidatus Mycoplasma haemolamae," "Candidatus Mycoplasma haemozalophi," and "Candidatus Mycoplasma kahanei" (see Fig. 1). Withal, based on the low levels (i.e., ≤97%) of sequence identity (29, 30) for five of the six raccoon hemoplasma genotypes (genotypes 2 to 6), nosotros believe these five genotypes correspond novel hemoplasma genotypes or putatively new hemoplasma species (see Fig. 1 and Tabular array 1) not yet described in other animal species.
Dendrogram showing phylogenetic relationships based on nucleotide sequence data for the 16S rRNA factor among the hemoplasma genotypes detected in raccoons (Procyon lotor) with other hemotropic Mycoplasma spp., and 3 nonhemotropic phylogenetically closely related Mycoplasma spp. (M. insons, M. fastidiosum, and Yard. cavipharyngis) and 2 not phylogenetically closely related Mycoplasma species. The trees were constructed by the minimum evolution method in the MEGA 6 bundle. Accretion numbers are shown to the left of each organism name; strain or isolate names are also shown.
The presence of regions of the low interspecies sequence similarity in the 16S rRNA genes among these five novel raccoon hemoplasma genotypes (genotypes 2 to 6) and the 16S rRNA genes of other hemoplasmas available in GenBank allowed us to design the species-specific PCR primers (Fig. S3 to S7 evidence detailed sequence comparisons) that can be used for qualitative detection of each hemoplasma genotype. In the current study, we used these species-specific 16S rRNA primers to demonstrate selective distension of each hemoplasma genotype in raccoon samples that were coinfected with dissimilar hemoplasma genotypes. No cross-distension between raccoon hemoplasma genotypes or faux-positive or false-negative amplifications were observed for these species-specific primers when used in PCR assays on DNA from all hemoplasma-positive and hemoplasma-negative raccoon claret Dna samples.
Prevalence of hemoplasmas in the studied animals in urban versus undisturbed ecosystems and coinfection.
The proportion of raccoons infected with hemotropic Mycoplasma spp. was 62.1% (95% confidence interval [CI], 51.5, 71.7%; n = 95), with overall proportions of 35.1% (95% CI, 20.7, 52.half-dozen%; n = 37) on St. Simons Island (developed habitat) and 79.3% (95% CI, 66.three, 88.4%; north = 58) on St. Catherines Island (undisturbed habitat). Hemoplasma infection prevalence was 17.9% (95% CI, 8.i, 34.1%; northward = 39) in feral cats from St. Simons. Overall, infection rates with hemoplasma were 44.4% (95% CI, 28.3, 61.vii%; n = 36) in female raccoons and 72.9% (95% CI, 59.5, 83.3%; due north = 59) in male person raccoons.
In univariate analyses, habitat and sex were significantly associated with hemoplasma infection in raccoons (habitat blazon, χ2 = xvi.9, df = 1, P = 0.00004; sex, χii = vi.52, df = ane, P = 0.01); hemoplasma infection prevalence was greater in male raccoons and on the undisturbed island. We likewise found a pregnant clan between hemoplasma infection and body mass (Isle of man-Whitney U test, Due west = 732, P = 0.01), although habitat blazon and trunk mass were not correlated (Mann-Whitney U test, Due west = 927.v, P = 0.27). We found no significant clan between host species (raccoon or feral cat) and hemoplasma infection on the urbanized island (χ2 = ii.89, df = one, P = 0.09). The all-time-fit generalized linear model (GLM) associated with raccoon hemoplasma infection included weight, habitat, and the interaction between weight and habitat (Tabular array S3). When the weight × urbanized habitat interaction was accounted for, the urbanized habitat was less likely to exist associated with hemoplasma infection (odds ratio [OR], −0.34, P = 0.02) than the undisturbed habitat. Specifically, heavier raccoons had greater odds of hemoplasma infection on the undisturbed island (OR, 1.3) but had lower odds of infection on the urban island (OR, 0.21) (Fig. S1).
Coinfection of raccoons with multiple hemoplasma genotypes was observed at both sampling sites: undisturbed habitat coinfection prevalence was 87% (xl/46), and urban habitat coinfection prevalence was 53.eight% (seven/13). Raccoons from the undisturbed habitat had a significantly higher number of individuals coinfected with more than 1 hemoplasma genotype than those from the urbanized habitat (χtwo = 52.989, df = i, P < 0.00001). The ratio of single infection to coinfection for the urban habitat was one/1.2 and was one/five.7 for the undisturbed habitat. Hemoplasma genotype richness and infection patterns in raccoons are shown in Table 2. At the population level, at that place was no difference in overall hemoplasma genotype richness (both sites had a total richness of 6 hemoplasma genotypes identified). Nevertheless, at the individual level, raccoons on St. Simons Isle (urban) had lower hemoplasma genotype richness than those on St. Catherines Island (undisturbed) (Kruskal-Wallis test, χ2 = 24.03, df = one, P < 0.0001; GLM, z = −5.88, df = 1, P < 0.0001).
Tabular array 2
Hemoplasma genotypes identified on adult (urban) and protected (undisturbed) islands
| Hemoplasma genotype detected in raccoons | Urban | Undisturbed | Full | |||
|---|---|---|---|---|---|---|
| % (n = 13) | 95% CI | % (n = 46) | 95% CI | % (n = 59) | 95% CI | |
| v | xv.4 | ii.7, 46.iii | 58.7 | 43.2, 72.7 | 49.ii | 36.0, 62.iv |
| 1 (G. haemocanis/M. haemofelis-like sp.) | 61.v | 32.37, 84.ix | 41.three | 27.3, 56.7 | 45.8 | 32.9, 59.2 |
| 2 | seven.seven | 0.4, 3.79 | 56.v | 41.2, 70.8 | 45.8 | 32.ix, 59.2 |
| 3 | thirty.8 | 10.iv, 61.1 | 60.9 | 45.4, 74.5 | 54.2 | 40.eight, 67.ane |
| 6 | 46.2 | 20.iv, 73.9 | 32.six | 20.0, 48.1 | 35.6 | 23.9, 49.2 |
| 4 | 23.i | 6.16, 54.0 | 43.5 | 29.2, 58.eight | 39.0 | 26.eight, 52.6 |
The mean number of hemoplasma genotypes identified per infected raccoon was 1.85 (range, ane to four genotypes) on the urbanized isle and 2.93 (range, one to 6 genotypes) on the undisturbed island. There was a slight positive merely nonsignificant correlation betwixt hemoplasma genotype richness and individual raccoon body weight (Spearman rank correlation, rho = 0.25, P = 0.06). Although raccoons at both sites had coinfections ranging from two to iv hemoplasma genotypes, coinfection with v to 6 genotypes was seen just in raccoons from the undisturbed site (Fig. S2). We also observed varied limerick of hemoplasma genotypes among raccoons; coinfections with two to iii hemoplasma genotypes were relatively evenly distributed. An association plot (Fig. 2) showed positive associations for coinfection for raccoon hemoplasma genotypes 2 and three, 2 and 4, 2 and 5, and 3 and four. Negative associations of coinfection were seen between genotypes 2 and 6, as well as One thousand. haemocanis/M. haemofelis-like sp. (genotype i) and genotype 2, and betwixt 1000. haemocanis/M. haemofelis-like sp. (genotype 1) and genotype iii.
Species cooccurrence matrix showing patterns of coinfection among the hemoplasma genotypes detected in raccoons. Results of the genotype cooccurrence matrix represent the probability (P value) of the cooccurrence observed beingness greater or less than that expected due to take chances. Only meaning P values (≤0.05) are shown.
Give-and-take
The genus Mycoplasma currently comprises twenty hemotropic species (https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=2093), and except for the well-established species M. haemocanis, Grand. haemofelis, and Grand. haemomuris, all other 17 hemoplasmas accept the conditional taxonomic status "Candidatus," as they are incompletely described prokaryotes (29,–31). Hemoplasmas infect dissimilar hosts and are able attach to, and sometimes intracellularly invade, their erythrocytes (vii, 10, 19). Hemoplasmas have non been cultured in vitro, and the detection of hemotropic mycoplasmas using Romanowsky-Giemsa- and/or acridine orangish-stained blood smears in combination with the PCR amplification of target hemoplasma genes is common laboratory exercise for diagnosing these infections in animals and humans (7, 10, 13, 14, 32,–34). However, the test of stained blood films for hemoplasmas (not performed in our study) has low sensitivity and specificity, and the absence of hemoplasma-like bodies on blood film oft does non correlate with the PCR results. Hemoplasma concentrations in the blood of animals may besides fluctuate during the course of a hemoplasma infection, and the low concentrations may non exist detected past microscopy (35), especially in immunocompetent chronically hemoplasma-infected animals. Therefore, microscopic blood film evaluation is occasionally omitted in multiple published studies on the investigation of hemoplasma infections in domestic or wild animals (20, 21, 36).
The reported prevalence of hemoplasma-infected animals in a variety of species ranges from 0.5 to 56.vii% (13, 18, twenty, 34, 37). In this study, the PCR screening using the HBT-F and HBT-R primers revealed that 62.1% of raccoons were hemoplasma infected. The apply of these published universal primers allowed us to successfully identify hemoplasma-positive animals; all the same, the direct sequencing (i.e., without cloning into a plasmid vector prior to the sequencing) of PCR products from animals coinfected with dissimilar mycoplasma genotypes was complicated or impossible due to the presence of the mixed PCR amplicons generated by these universal primers. The primers dilate the partial 16S rRNA of 595 to 620 bp in size, and the departure in 25 nucleotides (nt) was indistinguishable on electrophoresis in a 1% agarose gel. Thus, if the primers amplified the 16S fragment from animals coinfected with unlike mycoplasma genotypes, it was incommunicable to discriminate them on a gel and to obtain a clear sequence of them using the same HBT-F/R primers. To amplify all hemoplasmas (genotypes), we designed and used new primers that allowed us to amplify all genotypes separately and produce clear sequences from direct DNA sequencing of PCR amplicons. The new primers were able to dilate total-length 16S rRNA gene sequences of these hemoplasmas in raccoons in compliance with the recommendation of the subcommittee on the taxonomy of Mollicutes that in 2012 agreed to require the full-length 16S rRNA factor sequences in papers describing new hemoplasmas (28). The use of full-length 16S rRNA gene sequences for farther phylogenetic analysis may be especially necessary to distinguish between closely related bacterial species, and thus the sequencing of the full-length 16S rRNA factor is desirable and usually required when describing new species (38,–twoscore).
After the full-length 16S rRNA sequences for raccoon hemoplasmas were adamant, HBT-F/R primers were retrospectively analyzed for their matching to the hemoplasma sequences (against all 6 detected genotypes). The reverse primer (HBT-R) matched all genotypes with 100% identity. The forrad primer (HBT-F) matched genotypes one, 5, and 6 with 100% identity; yet, one mismatch (in assuming) was present in this region for all sequences of genotype three (HBT-F primer sequence, ATACGGCCCATATTCCTACG, versus the sequence of genotype 3, ATATGGCCCATATTCCTACG). Ii mismatches (in assuming) were present in this region for all sequences of genotype 4 (HBT-F primer sequence, ATACGGCCCATATTCCTACG, versus the sequence in genotype 4, ATATGGCCCATATCCCTACG). Despite the presence of these mismatches betwixt the frontward primer and the 16S rRNA sequences of genotypes 3 and 4, we did not detect any negative bear on on the results of our qualitative PCR with these universal primers. Nevertheless, for hereafter studies of hemoplasma infections in raccoons using HBT-F/R primers, we recommend introducing an ambiguous base (Y = C/T) at positions four and xiv of HBT-F, which may improve the sensitivity and yield of amplification of target hemoplasmas, specially in tested samples with depression Dna concentrations.
New primers for amplification of the full-length 16S rRNA genes allowed u.s.a. to detect vi hemoplasmas (genotypes) in raccoons with partial identity to the 16S rRNA gene sequences of known hemoplasma species. Based on depression levels (i.east., ≤97%) of sequence similarity of these hemoplasma genotypes to other described hemoplasmas and the mammalian host in which these genotypes were detected, nosotros believe that five of these vi genotypes represent novel hemoplasma genotypes or putatively novel hemoplasma species not yet described in other animal species.
Except for two raccoon hemoplasma genotypes, 1 and five (M. haemocanis/M. haemofelis-like), which had 96 to 97% nucleotide sequence identity with each other in their 16S rRNA genes, the other genotypes, 2 to 4 and half-dozen, demonstrated genetic similarity of ≤86 to 96% among these genotypes and to other known hemoplasma species. Just the 16S rRNA gene sequences of genotype i demonstrated 99% sequence identity to the 16S rRNA factor of M. haemocanis and Yard. haemofelis. Thou. haemocanis and M. haemofelis by themselves likewise have 99% sequence identity with each other in their 16S rRNA genes and are duplicate by the 16S rRNA gene analysis, without the sequencing of additional housekeeping genes, e.k., rpoB, gyrB, and others. To deeply place genotype ane as either M. haemocanis or Chiliad. haemofelis, we performed amplification of ii housekeeping genes (rpoB and gyrB). The amplification from the rpoB gene was unsuccessful using dissimilar Yard. haemocanis/M. haemofelis rpoB-specific primers, and just the gyrB gene was amplified for genotype ane; notwithstanding, nucleotide sequence analysis of the gyrB gene and the deduced poly peptide sequences demonstrated low similarities to both M. haemocanis and Grand. haemofelis. Thus, based on our results, we decided that the genotype ane detected in raccoons is unlikely to belong to the known species G. haemocanis or M. haemofelis but were closely related to them phylogenetically.
Phylogenetic studies of the 16S rRNA gene of closely related Mycoplasma species advise to utilize the capricious interspecies sequence similarity value of ≤97% equally a minimum level indicating a separate genetically afar species (29, thirty, 41). Data based on the expanded analysis of the 16S rRNA factor sequences of the species within the family Mycoplasmataceae generally support this proposition (29). Nevertheless, at least 20 pairs of closely related well-established Mycoplasma species with 16S rRNA gene similarity greater than 97% demonstrated serological, genetic, and ecological features that defined them as individual species, despite the high per centum of similarity of their 16S rRNA genes (for details, see reference 29). Thus, the 16S rRNA sequence identity of any new isolate of ≥98 to 99% may non be a clear indication that the Mycoplasma species is the same or different. Similar examples exist and are well known for some other closely related species with identical or nearly identical 16S rRNA sequences (42), e.g., Bacillus and Listeria species (43, 44).
Although well-nigh 62.1% of the raccoons in thus report were infected with hemoplasmas, they appeared normal upon concrete examination. The pathogenicity of the detected hemoplasmas for the raccoons is unknown and should be investigated in the futurity. From a taxonomic point of view, similar to cases of Eperythrozoon teganodes in cattle (28) and Haemobartonella spp. in horses (33), the genetic human relationship between the previously studied hemoplasma-like species Haemobartonella procyoni in raccoons of Maryland (27) and the hemoplasmas detected in raccoons this report is unknown, because there is no known H. procyoni genetic material in any national or international drove of microorganisms.
The three species of hemoplasma identified in feral cats on St. Simons Island have been previously detected in blood samples from cats throughout the globe, and the overall proportion of infected cats (17.9%) was within the reported prevalence in cats seen worldwide (16, 45,–51). The about mutual hemoplasma species found in cats in our written report, "Ca. Mycoplasma haemominutum," also appears to be the most mutual hemoplasma species in cats across many unlike studies (fifty, 51). Our written report detected no evidence of cross-species hemoplasma transmission between feral cats and raccoons, despite the close proximity of feral cats and raccoons on St. Simons Island.
Interactions between pathogen prevalence, diversity, and anthropogenic disturbance, such as urbanization, tin be positive, negative, or neutral, depending on the blazon of ecology change and how it affects affluence, density, and/or contact within and between host species, other coinfecting pathogens, and ecology influences on host amnesty and pathogen susceptibility (52,–54). The proportion of hemoplasma-infected raccoons was greater on the undisturbed than on the urbanized island, and the proportion of hemoplasma-infected raccoons in both locations was higher than in urban cats. If hemoplasma transmission is population density dependent, an increase in hemoplasma infection in urbanized habitats is expected (55, 56). We did not see evidence of this, because trapping success on the urban isle (0.41 animals/trap nighttime) was higher than on the protected isle (0.24 animals/trap night). However, we did not perform mark-recapture studies for density estimation. Regardless, in urbanized areas, raccoons may be more than probable to enter traps due to greater habituation and differing food preferences. Alternatively, hemoplasma manual may be frequency dependent, due to bites, scratches, licking (fifty), and potential vector-borne (flea/tick) transmission. Assuming that hemoplasma infection tin can exist vector-borne in wild raccoons, as has been found in cats (ten, 46), habitat-related differences in microclimate could influence hemoplasma transmission. The prevalence of tick-borne diseases and tick infestation rates in host species is often higher in natural habitats than in urban environments (57, 58), related to insufficient host diversity to maintain complex tick life cycles in urbanized areas (59).
The all-time-fit GLM showed a positive human relationship between heavier animals and hemoplasma infection in undisturbed habitats, whereas heavier animals in urban habitats had lower odds of infection. Although associations betwixt sex and hemoplasma infection were male biased and marginally significant in univariate analyses, sexual activity was not a significant predictor of hemoplasma infection in our best-fit GLMs. The positive association between body weight and hemoplasma infection in the undisturbed habitat could exist related to host age; although nosotros did non determine the age of captured raccoons, larger individuals were likely to be older and may have had increased exposure to ectoparasites (if arthropod-borne manual is a dominant mode of manual) or higher ectoparasite infestation. The ascertainment of a positive relationship between weight and hemoplasma positivity in the undisturbed environs might suggest that heavier animals may have greater contact with other infected animals or vectors. For the contrary consequence in an urban habitat, supplemental feeding (garbage and deliberate feral fauna feeding by residents) on St. Simons Island might have led to higher tolerance by raccoons toward conspecific animals, which may reduce aggressive (60) behavior, reducing the likelihood of fighting and hemoplasma transmission through infected blood or saliva. Higher food availability or quality in urban habitats (if raccoons were existence fed nutritionally rich supplements, such equally cat food) could permit heavier raccoons to mountain a more successful immune defense against hemoplasma (61). Additional routes of transmission for hemoplasmas, such equally transplacental and transmammary manual (32), may besides influence differences in hemoplasma prevalence, specially if one population has a different population age structure.
Differences in population management of raccoons between islands may influence the prevalence of hemoplasma infection. Although there are no published data available on the relative population densities of raccoons on these two islands, raccoons are routinely culled on St. Catherines Island to protect impairment to ocean turtle nests. Culling may inadvertently increase the manual of pathogens with frequency-dependent transmission in role past increasing the nascency rate, leading to an increment in susceptible individuals in a population (62). However, further study is required to thoroughly understand the epidemiology and mode of hemotropic mycoplasmas in raccoons in order to pinpoint the causes for differences in infection rates between undisturbed and disturbed habitats.
Coinfection with multiple hemoplasmas has been described in humans (sixteen), domestic animals (45, 63, 64), and wildlife (36). Nonetheless, it remains unknown why patterns of hemoplasma coinfection vary amongst raccoons and habitats. For instance, negative cooccurrence of some hemoplasmas (Fig. 2) may be due to cross-immunity, ecological interference, or differing contact networks (65) between raccoons in different habitat types. One possible explanation for our results is that the protected isle offers a greater opportunity for within-species and cross-species hemoplasma transmission due to contacts with a more various host community.
Horizontal transmission of hemotropic mycoplasmas in species other than raccoons has been hypothesized to be potentially associated with blood-feeding arthropod vectors, as well as straight transmission via infected blood (e.g., aggressive interactions and injuries related to animal-to-animal contact, and contact with claret) (x, 66,–68). All these transmission routes may business relationship for the widespread occurrence of hemoplasmas in the studied raccoon populations and require additional investigation.
To conclude, this study identified novel hemoplasma genotypes in raccoons and provided new molecular tools to observe these species. We identified six hemoplasma genotypes in raccoons that were phylogenetically related to hemoplasma species previously reported in other mammalian hosts (see Fig. 1). Five of these six hemoplasmas appear to be novel hemoplasma genotypes (i.east., never previously reported or deposited in GenBank). Time to come studies should (i) explore the probability of cantankerous-species manual with boosted samples from various sympatric host species and (2) evaluate the pathogenicity of hemoplasmas in raccoons, especially using hematological and immunological assays. The potential mechanism of intra- and interspecies transmission of hemoplasmas and the drivers of its species composition in sympatric host species remain to be elucidated.
Conclusion.
This study provides data nigh novel hemoplasmas in raccoons (Procyon lotor), which can exist used for assessments of the prevalence of these hemoplasmas in raccoon populations. Raccoons from the undisturbed habitat had college hemoplasma infection rates than raccoons in a rural habitat. There does not announced to be cross-species transmission of hemotropic mycoplasmas between urban raccoons and feral cats.
MATERIALS AND METHODS
Field sites and report populations.
Raccoons were live-trapped on two Georgia coast barrier islands, St. Simons Island (31°nine′xl″Northward 81°23′13W) and St. Catherines Island (31°37′50″N 81°nine′36.5W), which is approximately l km north of St. Simons Island. St. Simons Island has circuitous ecosystems, including ocean embankment, common salt marsh, maritime forest, and freshwater slough. In addition, St. Simons Island is 1 of the well-nigh urbanized Georgia Barrier Islands, with a large resident human population and rapidly increasing residential developments (69). St. Catherines Island also has diverse habitats, including marsh, deciduous and evergreen forest, palmetto scrub, and open up savannah (70). St. Catherines is a protected barrier island for scientific research, with no human evolution, residential areas, or domestic animals. Developed feral cats were live-trapped on St. Simons Island as a office of spay/neuter program and physically examined past local veterinarians; no data on the sex of these feral cats was recorded.
Sample collection.
Raccoons (northward = 95) were trapped in the spring and summer of 2012 along trapping transects using 20 Tomahawk traps (Tomahawk Alive Trap Visitor, Tomahawk, WI, USA). Raccoons were anesthetized by intramuscular injection of ketamine (20 mg/kg of body weight; Aveco Co., Fort Dodge, IA, USA) mixed with xylazine (iv mg/kg; Mobay Corp., Brute Health Division, Shawnee, KS, USA). The body weight of each animal was measured, and their general physical health was evaluated by local veterinarians. Approximately 3 ml of blood was nerveless from all animals (raccoons and cats) by jugular venipuncture into vacuum tubes containing anticoagulant (EDTA) tubes. Blood samples from feral urban cats (n = 39) were collected by local veterinarians every bit function of the concrete examination for the St. Simons Island spay/neuter program. Whole-claret samples in the EDTA tubes were stored at −20°C until laboratory analysis. In full, we collected 37 and 58 raccoon blood samples from St. Simons Isle and St. Catherines Island, respectively. Institutional Animate being Intendance and Use Committee (A2011 03-042-Y2-A2) and Georgia Department of Natural Resource wildlife permits (29-WBH-12-100) were obtained before sampling (71).
DNA extraction, PCR distension, and sequencing of amplicons.
Full DNA was extracted from 200 μl of blood from each individual using the DNeasy claret and tissue kit (Qiagen, Valencia, CA, USA) or the Quick-gDNA MiniPrep kit (Zymo Research Corporation, Orange, CA, USA) according to the manufacturers' protocols and with standard clinical PCR laboratory precautions to avert cross-contamination. DNA samples were stored at −80°C until apply.
The primary screening for the presence of hemoplasmas was performed by PCR using previously published HBT-F and HBT-R universal primers for amplification of the partial 16S rRNA hemoplasma genes (37). These primers dilate the 16S rRNA gene region from positions 313 to 332 to positions 889 to 908 based on the 16S rRNA gene reference sequence of M. haemofelis (accretion no. {"type":"entrez-nucleotide","attrs":{"text":"AF178677","term_id":"6708131","term_text":"AF178677"}}AF178677) (37, 72). Based on our in silico PCR analysis (72) of these universal primers against the unlike mycoplasma 16S rRNA factor sequences bachelor in the GenBank database, it was demonstrated that depending on the target Mycoplasma spp., these primers produce PCR fragments with sizes of 595 to 620 bp. In addition, these universal primers were successfully used for amplification of the fractional 16S rRNA hemoplasma genes in a few published studies (73,–75).
A second aliquot of whole claret from each of the hemoplasma-positive samples was used to isolate additional DNA for amplification of the full-length 16S rRNA factor, the RNA polymerase beta-subunit gene (rpoB), and the DNA gyrase subunit B gene (gyrB) using PCR primers designed in this written report (Table S1). Eight primer pairs were designed to dilate the total-length 16S rRNA genes, three primer sets were designed to amplify office of rpoB, and i primer set was designed to amplify role of gyrB based on sequences of other known hemoplasma species available at GenBank (Tabular array S1, 16S-PCR-1 through 16S-PCR-viii, and PCR-A through PCR-D).
The 16S rRNA amplicons produced were directly sequenced (with and without cloning into a plasmid vector) by Macrogen, and the rpoB and the gyrB amplicons were sequenced straight without cloning. Prior to sequencing, PCR amplicons were purified by electrophoresis using 1.five% agarose gels and extracted with the QIAquick gel extraction kit (Qiagen). Amplicons were sequenced with the same primers used for PCR amplification and so with internal (walking) primers when needed. Cloned amplicons were produced equally described elsewhere (29), and 15 to 20 clones of the 16S rRNA gene PCR products of each amplicon were sequenced and analyzed.
When the full-length 16S rRNA gene sequences of the hemoplasma genotypes of raccoons were determined, species-specific 16S rRNA primers to selectively amplify each hemoplasma genotype identified in raccoons were designed (meet Table S1, 16S-PCR-9 through 16S-PCR-13). Nosotros used these species-specific 16S rRNA primers to selectively identify each hemoplasma genotype in blood samples from raccoons coinfected with different hemoplasma genotypes. The selectivity of these primers for each hemoplasma genotype was demonstrated by gel electrophoresis (i.e., the presence of a single amplicon band) and straight sequencing of amplicons.
The distension mixture for all PCRs (for direct sequencing without cloning) contained 5 μl of 10× HotStarTaq PCR buffer, i.5 mM MgCltwo, 200 mM dinucleoside triphosphate (dNTP) mixture, 1 mM each primer, and 2.five U of HotStarTaq Plus Dna polymerase (Qiagen) in a final volume of 50 μl, including 3 μl of DNA template. The Vent Deoxyribonucleic acid polymerase kit (New England BioLabs), which contains loftier-allegiance thermophilic Vent DNA polymerase, was used for the amplification of PCR products for subsequent cloning and sequencing using plasmid DNA. The absence of PCR inhibitors in isolated blood DNAs was confirmed by PCR amplification of the Procyon lotor mitochondrial gene for 16S rRNA, as an extraction positive control (76) (with primers F1-Animal and R1-Animal) on each sample and negative (no DNA added) PCR command were run for each PCR analysis. The DNA of K. haemocanis and "Ca. Mycoplasma haemominutum" was used equally a positive control for the PCRs with the primers PCR-A through PCR-D.
All PCRs in this written report were conducted under the following conditions: a polymerase activation step at 94°C for 5 min (or 15 min for HotStarTaq simply), 40 cycles of 95°C for 30 s, 60°C for 60 s, and 72°C for lx s, and a final extension at 72°C for 10 min. PCR products were detected by electrophoresis through ane% Tris-acetate-EDTA (TAE)–agarose gels containing ethidium bromide concentrations, followed by UV visualization.
Phylogenetic assay.
The 16S rRNA sequences determined in this written report were compared to those available in the GenBank database using procedures, algorithms, and methods for phylogenetic tree inference, equally described elsewhere (eighteen, 29). To avoid the potential presence for chimeric sequences or PCR-derived variants in the information set, all hemoplasma 16S rRNA PCR products for phylogenetic analyses were directly amplified from blood Dna samples of raccoons and cats with ii different Dna polymerases (HotStarTaq and Vent) and were directly sequenced without cloning (77, 78). All factor sequences prior to the downstream phylogenetic analysis were subjected to the chimeric sequence analysis using DECIPHER (79) and UCHIME (80). All sequences are deposited in GenBank and are publicly available.
Ecological data assay.
All statistical analyses were performed using R (http://cran.r-project.org) (81). A descriptive assay of the hemoplasma infection status of animals nerveless in each habitat blazon was performed. For univariate analyses, nosotros used Pearson'southward chi-square tests to compare the frequency of hemoplasma infection in raccoons in urban and undisturbed environments, raccoon sex activity and hemoplasma infection, raccoon hemoplasma coinfection and habitat blazon, and hemoplasma infection in urban cats and raccoons. Additional univariate analyses included a Isle of man-Whitney U test to evaluate differences between habitat type and raccoon torso mass, hemoplasma infection and body mass, and habitat type and body mass. A Kruskal-Wallis exam and a generalized linear model (GLM) with Poisson errors were used to evaluate associations between hemoplasma species richness in individual raccoons and trunk weight. We used a global GLM with individual hemoplasma infection status (positive or negative) every bit a response variable with a binomial fault construction to identify factors that may affect mycoplasma prevalence (82). Sexual activity, habitat type, and body weight were included equally explanatory variables alongside biologically meaningful interactions between covariates. Using the R package AICcmodavg, nosotros applied a stepwise algorithm and calculated Akaike's information criteria corrected for small sample sizes (AICc) to determine which prepare of covariates provided the best fit to the data. A species cooccurrence matrix was calculated to evaluate if coinfecting putative hemoplasma species were negatively, randomly, or positively associated with ane another within each host using the R package cooccur (83).
Accession number(s).
All DNA sequences from this study were deposited in GenBank under the accession numbers {"type":"entrez-nucleotide","attrs":{"text":"KF743704","term_id":"568603867","term_text":"KF743704"}}KF743704 to {"type":"entrez-nucleotide","attrs":{"text":"KF743751","term_id":"568603925","term_text":"KF743751"}}KF743751, {"type":"entrez-nucleotide","attrs":{"text":"KC920439","term_id":"509315495","term_text":"KC920439"}}KC920439 to {"type":"entrez-nucleotide","attrs":{"text":"KC920448","term_id":"509315504","term_text":"KC920448"}}KC920448, and {"type":"entrez-nucleotide","attrs":{"text":"KC936280","term_id":"507579703","term_text":"KC936280"}}KC936280.
Supplementary Material
ACKNOWLEDGMENTS
Funding for this research was provided by St. Catherines Isle Foundation, Inc. through the American Museum of Natural History and the Odum Schoolhouse of Ecology, UGA, through Vanessa Ezenwa and Andrew Park. H. Danaceau was supported by grant 9T35OD010433-06 from the Office of the Director, a component of the National Institutes of Health (NIH). The contents of this article are solely the responsibleness of the authors and do not necessarily represent the official views of the NIH.
We thank Joanne Messick, Andreas Santos, and Michael Yabsley for communication, Mark Heth, Sea Island Hospital of St. Simons Isle, for providing samples, and Veronica Greco, Royce Hayes, and on-site staff of St. Catherines Island for technical communication and assist during the fieldwork on the island. We also give thanks Daniel Becker for disquisitional review of the manuscript and three anonymous reviewers for providing comments on an earlier draft of the manuscript.
We declare no conflicts of interest.
Footnotes
REFERENCES
1. Shochat East, Warren PS, Faeth SH, McIntyre NE, Hope D. 2006. From patterns to emerging processes in mechanistic urban ecology. Trends Ecol Evol 21:186–191. doi:10.1016/j.tree.2005.eleven.019. [PubMed] [CrossRef] [Google Scholar]
2. Bradley CA, Altizer S. 2007. Urbanization and the environmental of wildlife diseases. Trends Ecol Evol 22:95–102. doi:10.1016/j.tree.2006.11.001. [PMC complimentary article] [PubMed] [CrossRef] [Google Scholar]
3. Gehrt SD, Riley SPD, Nothing BL. 2010. Urban carnivores: ecology, conflict, and conservation. Johns Hopkins University Press, Baltimore, Dr.. [Google Scholar]
four. Wright AN, Gompper ME. 2005. Contradistinct parasite assemblages in raccoons in response to manipulated resource availability. Oecologia 144:148–156. doi:10.1007/s00442-005-0018-three. [PubMed] [CrossRef] [Google Scholar]
v. Becker DJ, Streicker DG, Altizer S. 2015. Linking anthropogenic resources to wildlife-pathogen dynamics: a review and meta-analysis. Ecol Lett 18:483–495. doi:10.1111/ele.12428. [PMC free commodity] [PubMed] [CrossRef] [Google Scholar]
half dozen. Hadidian J, Prange S, Rosatte R, Riley SPD, Gehrt SD. 2010. Raccoons (Procyon lotor), p 35–47. In Gehrt SD, Riley SPD, Zero BL (ed), Urban carnivores: ecology, conflict, and conservation. Johns Hopkins Press, Baltimore, MD. [Google Scholar]
vii. Messick JB. 2004. Hemotrophic mycoplasmas (hemoplasmas): a review and new insights into pathogenic potential. Vet Clin Pathol 33:2–13. doi:10.1111/j.1939-165X.2004.tb00342.ten. [PubMed] [CrossRef] [Google Scholar]
8. Neimark H, Kocan KM. 1997. The cell wall-less rickettsia Eperythrozoon wenyonii is a mycoplasma. FEMS Microbiol Lett 156:287–291. doi:10.1111/j.1574-6968.1997.tb12742.x. [PubMed] [CrossRef] [Google Scholar]
nine. Neimark H, Peters W, Robinson BL, Stewart LB. 2005. Phylogenetic analysis and description of Eperythrozoon coccoides, proposal to transfer to the genus Mycoplasma as Mycoplasma coccoides comb. nov. and request for an opinion. Int J Syst Evol Microbiol 55:1385–1391. doi:ten.1099/ijs.0.63437-0. [PubMed] [CrossRef] [Google Scholar]
x. Willi B, Boretti FS, Tasker Due south, Meli ML, Wengi N, Reusch CE, Lutz H, Hofmann-Lehmann R. 2007. From Haemobartonella to hemoplasma: molecular methods provide new insights. Vet Microbiol 125:197–209. doi:10.1016/j.vetmic.2007.06.027. [PubMed] [CrossRef] [Google Scholar]
11. Uilenberg G, Thiaucourt F, Jongejan F. 2006. Mycoplasma and Eperythrozoon (Mycoplasmataceae). Comments on a recent paper. Int J Syst Evol Microbiol 56:thirteen–fourteen. doi:ten.1099/ijs.0.63998-0. [PubMed] [CrossRef] [Google Scholar]
12. Sykes JE. 2010. Feline hemotropic mycoplasmas. Vet Clin N Am Minor Anim Pract 40:1157–1170. doi:10.1016/j.cvsm.2010.07.003. [PubMed] [CrossRef] [Google Scholar]
thirteen. Dieckmann SM, Hoelzle K, Dieckmann MP, Straube I, Hofmann-Lehmann R, Hoelzle LE. 2012. Occurrence of hemotrophic mycoplasmas in horses with correlation to hematological findings. Vet Microbiol 160:43–52. doi:10.1016/j.vetmic.2012.05.016. [PubMed] [CrossRef] [Google Scholar]
14. dos Santos AP, dos Santos RP, Biondo AW, Dora JM, Goldani LZ, de Oliveira ST, de Sa Guimaraes AM, Timenetsky J, de Morais HA, Gonzalez FH, Messick JB. 2008. Hemoplasma infection in HIV-positive patient, Brazil. Emerg Infect Dis fourteen:1922–1924. doi:10.3201/eid1412.080964. [PMC costless commodity] [PubMed] [CrossRef] [Google Scholar]
15. Steer JA, Tasker S, Barker EN, Jensen J, Mitchell J, Stocki T, Chalker VJ, Hamon M. 2011. A novel hemotropic Mycoplasma (hemoplasma) in a patient with hemolytic anemia and pyrexia. Clin Infect Dis 53:e147–. doi:x.1093/cid/cir666. [PMC costless commodity] [PubMed] [CrossRef] [Google Scholar]
sixteen. Sykes JE, Lindsay LL, Maggi RG, Breitschwerdt EB. 2010. Human coinfection with Bartonella henselae and two hemotropic mycoplasma variants resembling Mycoplasma ovis . J Clin Microbiol 48:3782–3785. doi:x.1128/JCM.01029-10. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
17. Reynolds CA, Lappin MR. 2007. "Candidatus Mycoplasma haemominutum" infections in 21 client-owned cats. J Am Anim Hosp Assoc 43:249–257. doi:10.5326/0430249. [PubMed] [CrossRef] [Google Scholar]
18. Volokhov DV, Norris T, Rios C, Davidson MK, Messick JB, Gulland FM, Chizhikov VE. 2011. Novel hemotrophic mycoplasma identified in naturally infected California sea lions (Zalophus californianus). Vet Microbiol 149:262–268. doi:10.1016/j.vetmic.2010.10.026. [PubMed] [CrossRef] [Google Scholar]
19. Groebel Grand, Hoelzle K, Wittenbrink MM, Ziegler U, Hoelzle LE. 2009. Mycoplasma suis invades porcine erythrocytes. Infect Immun 77:576–584. doi:10.1128/IAI.00773-08. [PMC gratuitous article] [PubMed] [CrossRef] [Google Scholar]
20. Cabello J, Altet L, Napolitano C, Sastre Due north, Hidalgo Eastward, Davila JA, Millan J. 2013. Survey of infectious agents in the endangered Darwin'southward fox (Lycalopex fulvipes): high prevalence and diversity of hemotrophic mycoplasmas. Vet Microbiol 167:448–454. doi:10.1016/j.vetmic.2013.09.034. [PubMed] [CrossRef] [Google Scholar]
21. Iso T, Suzuki J, Sasaoka F, Sashida H, Watanabe Y, Fujihara M, Nagai K, Harasawa R. 2013. Hemotropic mycoplasma infection in wild black bears (Ursus thibetanus japonicus). Vet Microbiol 163:184–189. doi:10.1016/j.vetmic.2012.12.016. [PubMed] [CrossRef] [Google Scholar]
22. Krengel A, Meli ML, Cattori V, Wachter B, Willi B, Thalwitzer Due south, Melzheimer J, Hofer H, Lutz H, Hofmann-Lehmann R. 2013. Commencement bear witness of hemoplasma infection in free-ranging Namibian cheetahs (Acinonyx jubatus). Vet Microbiol 162:972–976. doi:10.1016/j.vetmic.2012.10.009. [PubMed] [CrossRef] [Google Scholar]
23. Hirata G, Tateno 1000, Sakuma K, Nakanishi North, Izawa Thousand, Asari Y, Okamura M, Shimokawa Miyama T, Setoguchi A, Endo Y. 2012. An epidemiological survey of hemoplasma infection in Iriomote cats (Prionailurus bengalensis iriomotensis). J Vet Med Sci 74:1531–1537. doi:ten.1292/jvms.12-0094. [PubMed] [CrossRef] [Google Scholar]
24. Harasawa R, Orusa R, Giangaspero M. 2014. Molecular bear witness for hemotropic mycoplasma infection in a Japanese badger (Meles meles anakuma) and a raccoon dog (Nyctereutes procyonoides viverrinus). J Wildl Dis 50:412–415. doi:10.7589/2013-09-229. [PubMed] [CrossRef] [Google Scholar]
25. Sharifiyazdi H, Nazifi S, Shirzad Aski H, Shayegh H. 2014. Molecular label and phylogenetic assay of the causative amanuensis of hemoplasma infection in small Indian mongoose (Herpestes javanicus). Comp Immunol Microbiol Infect Dis 37:243–247. doi:10.1016/j.cimid.2014.07.002. [PubMed] [CrossRef] [Google Scholar]
26. Pinard CL, Brightman AH, Yeary TJ, Everson TD, Cox LK, Chengappa MM, Davidson HJ. 2002. Normal conjunctival flora in the North American opossum (Didelphis virginiana) and raccoon (Procyon lotor). J Wildl Dis 38:851–855. doi:10.7589/0090-3558-38.4.851. [PubMed] [CrossRef] [Google Scholar]
27. Frerichs WM, Holbrook AA. 1971. Haemobartonella procyoni sp. n. in the raccoon, Procyon lotor . J Parasitol 57:1309–1310. doi:10.2307/3277988. [PubMed] [CrossRef] [Google Scholar]
28. Firrao G, Brown DR. 2013. International Committee on Systematics of Prokaryotes. Subcommittee on the taxonomy of Mollicutes: minutes of the meetings, July 15th and 19th 2012, Toulouse, French republic. Int J Syst Evol Microbiol 63:2361–2364. [PubMed] [Google Scholar]
29. Volokhov DV, Simonyan 5, Davidson MK, Chizhikov VE. 2012. RNA polymerase beta subunit (rpoB) gene and the 16S-23S rRNA intergenic transcribed spacer region (ITS) as complementary molecular markers in add-on to the 16S rRNA gene for phylogenetic analysis and identification of the species of the family Mycoplasmataceae . Mol Phylogenet Evol 62:515–528. doi:10.1016/j.ympev.2011.11.002. [PubMed] [CrossRef] [Google Scholar]
xxx. Brown DR, Whitcomb RF, Bradbury JM. 2007. Revised minimal standards for description of new species of the course Mollicutes (division Tenericutes). Int J Syst Evol Microbiol 57:2703–2719. doi:10.1099/ijs.0.64722-0. [PMC free commodity] [PubMed] [CrossRef] [Google Scholar]
31. Murray RG, Stackebrandt E. 1995. Taxonomic note: implementation of the provisional status Candidatus for incompletely described prokaryotes. Int J Syst Bacteriol 45:186–187. doi:10.1099/00207713-45-1-186. [PubMed] [CrossRef] [Google Scholar]
32. Almy FS, Ladd SM, Sponenberg DP, Crisman MV, Messick JB. 2006. Mycoplasma haemolamae infection in a 4-day-one-time cria: support for in utero manual by use of a polymerase chain reaction assay. Can Vet J 47:229–233. [PMC free article] [PubMed] [Google Scholar]
33. Dieckmann SM, Winkler Thou, Groebel K, Dieckmann MP, Hofmann-Lehmann R, Hoelzle K, Wittenbrink MM, Hoelzle LE. 2010. Haemotrophic Mycoplasma infection in horses. Vet Microbiol 145:351–353. doi:10.1016/j.vetmic.2010.04.009. [PubMed] [CrossRef] [Google Scholar]
34. Hu Z, Yin J, Shen K, Kang W, Chen Q. 2009. Outbreaks of hemotrophic mycoplasma infections in Mainland china. Emerg Infect Dis 15:1139–1140. doi:ten.3201/eid1507.090174. [PMC costless article] [PubMed] [CrossRef] [Google Scholar]
35. Johnson KA, do Nascimento NC, Bauer AE, Weng HY, Hammac GK, Messick JB. 2016. Detection of hemoplasma infection of goats past apply of a quantitative polymerase concatenation reaction assay and take a chance factor analysis for infection. Am J Vet Res 77:881–888. [PubMed] [Google Scholar]
36. Maggi RG, Chitwood MC, Kennedy-Stoskopf S, DePerno CS. 2013. Novel hemotropic Mycoplasma species in white-tailed deer (Odocoileus virginianus). Comp Immunol Microbiol Infect Dis 36:607–611. doi:10.1016/j.cimid.2013.08.001. [PubMed] [CrossRef] [Google Scholar]
37. Criado-Fornelio A, Martinez-Marcos A, Buling-Sarana A, Barba-Carretero JC. 2003. Presence of Mycoplasma haemofelis, Mycoplasma haemominutum and piroplasmids in cats from southern Europe: a molecular study. Vet Microbiol 93:307–317. doi:x.1016/S0378-1135(03)00044-0. [PubMed] [CrossRef] [Google Scholar]
38. Clarridge JE., III 2004. Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clin Microbiol Rev 17:840–862. doi:ten.1128/CMR.17.iv.840-862.2004. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
39. Franzén O, Hu JZ, Bao 40, Itzkowitz SH, Peter I, Bashir A. 2015. Improved OTU-picking using long-read 16S rRNA cistron amplicon sequencing and generic hierarchical clustering. Microbiome 3:ane–fourteen. doi:10.1186/s40168-014-0066-1. [CrossRef] [Google Scholar]
40. Schloss PD. 2010. The effects of alignment quality, distance calculation method, sequence filtering, and region on the analysis of 16S rRNA gene-based studies. PLoS Comput Biol 6:e1000844. doi:10.1371/journal.pcbi.1000844. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
41. Pettersson B, Tully JG, Bolske G, Johansson KE. 2000. Updated phylogenetic clarification of the Mycoplasma hominis cluster (Weisburg et al. 1989) based on 16S rDNA sequences. Int J Syst Evol Microbiol 50:291–301. doi:10.1099/00207713-50-one-291. [PubMed] [CrossRef] [Google Scholar]
42. Rosselló-Mora R, Amann R. 2001. The species concept for prokaryotes. FEMS Microbiol Rev 25:39–67. doi:10.1111/j.1574-6976.2001.tb00571.x. [PubMed] [CrossRef] [Google Scholar]
43. Fox GE, Wisotzkey JD, Jurtshuk P Jr. 1992. How close is shut: 16S rRNA sequence identity may not exist sufficient to guarantee species identity. Int J Syst Bacteriol 42:166–170. doi:10.1099/00207713-42-1-166. [PubMed] [CrossRef] [Google Scholar]
44. Sallen B, Rajoharison A, Desvarenne S, Quinn F, Mabilat C. 1996. Comparative assay of 16S and 23S rRNA sequences of Listeria species. Int J Syst Bacteriol 46:669–674. doi:10.1099/00207713-46-3-669. [PubMed] [CrossRef] [Google Scholar]
45. Willi B, Tasker S, Boretti FS, Doherr MG, Cattori V, Meli ML, Lobetti RG, Malik R, Reusch CE, Lutz H, Hofmann-Lehmann R. 2006. Phylogenetic analysis of "Candidatus Mycoplasma turicensis" isolates from pet cats in the Uk, Commonwealth of australia, and Due south Africa, with analysis of adventure factors for infection. J Clin Microbiol 44:4430–4435. doi:10.1128/JCM.00987-06. [PMC costless article] [PubMed] [CrossRef] [Google Scholar]
46. Willi B, Filoni C, Catao-Dias JL, Cattori V, Meli ML, Vargas A, Martinez F, Roelke ME, Ryser-Degiorgis MP, Leutenegger CM, Lutz H, Hofmann-Lehmann R. 2007. Worldwide occurrence of feline hemoplasma infections in wild felid species. J Clin Microbiol 45:1159–1166. doi:ten.1128/JCM.02005-06. [PMC complimentary article] [PubMed] [CrossRef] [Google Scholar]
47. Tasker S, Helps CR, Day MJ, Harbour DA, Shaw SE, Harrus S, Baneth G, Lobetti RG, Malik R, Beaufils JP, Belford CR, Gruffydd-Jones TJ. 2003. Phylogenetic analysis of hemoplasma species: an international study. J Clin Microbiol 41:3877–3880. doi:10.1128/JCM.41.8.3877-3880.2003. [PMC free commodity] [PubMed] [CrossRef] [Google Scholar]
48. Willi B, Boretti FS, Cattori V, Tasker S, Meli ML, Reusch C, Lutz H, Hofmann-Lehmann R. 2005. Identification, molecular characterization, and experimental manual of a new hemoplasma isolate from a true cat with hemolytic anemia in Switzerland. J Clin Microbiol 43:2581–2585. doi:x.1128/JCM.43.vi.2581-2585.2005. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
49. Lobetti RG, Tasker S. 2004. Diagnosis of feline haemoplasma infection using a existent-fourth dimension PCR assay. J S Afr Vet Assoc 75:94–99. [PubMed] [Google Scholar]
50. Sykes JE. 2010. Feline hemotropic mycoplasmas. J Vet Emerg Crit Care (San Antonio) xx:62–69. doi:ten.1111/j.1476-4431.2009.00491.x. [PubMed] [CrossRef] [Google Scholar]
51. Duarte A, Marques V, Correia JH, Neto I, Braz BS, Rodrigues C, Martins T, Rosado R, Ferreira JP, Santos-Reis Thousand, Tavares Fifty. 2015. Molecular detection of haemotropic Mycoplasma species in urban and rural cats from Portugal. J Feline Med Surg 17:516–522. doi:10.1177/1098612X14550172. [PubMed] [CrossRef] [Google Scholar]
52. Poulin R. 2007. Evolutionary ecology of parasites, 2nd ed Princeton University Press, Princeton, NJ. [Google Scholar]
53. Budria A, Candolin U. 2013. How does human-induced environmental alter influence host-parasite interactions? Parasitology 141:462–474. doi:10.1017/S0031182013001881. [PubMed] [CrossRef] [Google Scholar]
54. Lafferty KD. 1997. Ecology parasitology: what tin parasites tell us about human impacts on the environment? Parasitol Today xiii:251–255. doi:x.1016/S0169-4758(97)01072-7. [PubMed] [CrossRef] [Google Scholar]
55. Miller R, Kaneene JB, Fitzgerald SD, Schmitt SM. 2003. Evaluation of the influence of supplemental feeding of white-tailed deer (Odocoileus virginianus) on the prevalence of bovine tuberculosis in the Michigan wild deer population. J Wildl Dis 39:84–95. doi:10.7589/0090-3558-39.i.84. [PubMed] [CrossRef] [Google Scholar]
56. Tempest DJ, Samuel M, Rolley RE, Shelton P, Keuler NS, Richards BJ, Van Deelen TR. 2013. Deer density and disease prevalence influence transmission of chronic wasting disease in white-tailed deer. Ecosphere four:1–14. [Google Scholar]
57. Evans KL, Gaston KJ, Sharp SP, McGowan A, Simeoni M, Hatchwell BJ. 2009. Effects of urbanisation on affliction prevalence and age structure in blackbird Turdus merula populations. Oikos 118:774–782. doi:10.1111/j.1600-0706.2008.17226.ten. [CrossRef] [Google Scholar]
58. Geue D, Partecke J. 2008. Reduced parasite infestation in urban Eurasian blackbirds (Turdus merula): a factor favoring urbanization? Can J Zool 86:1419–1425. doi:10.1139/Z08-129. [CrossRef] [Google Scholar]
59. Gregoire A, Faivre B, Heeb P, Cezilly F. 2002. A comparing of infestation patterns by Ixodes ticks in urban and rural populations of the mutual blackbird Turdus merula . Ibis 144:640–645. doi:10.1046/j.1474-919X.2002.00102.x. [CrossRef] [Google Scholar]
sixty. Prange South, Gehrt S, Wiggers E. 2004. Influences of anthropogenic resources on raccoon (Procyon lotor) movements and spatial distribution. J Mammal 85:483–490. doi:10.1644/BOS-121. [CrossRef] [Google Scholar]
61. Becker DJ, Hall RJ. 2014. Too much of a good thing: resource provisioning alters infectious disease dynamics in wildlife. Biol Lett 10:pii:20140309. doi:10.1098/rsbl.2014.0309. [PMC free commodity] [PubMed] [CrossRef] [Google Scholar]
62. Choisy M, Rohani P. 2006. Harvesting can increase severity of wild animals illness epidemics. Proc Biol Sci 273:2025–2034. doi:10.1098/rspb.2006.3554. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
63. Tagawa K, Takeuchi T, Fujisawa T, Konno Y, Yamamoto S, Matsumoto K, Yokoyama N, Inokuma H. 2012. A clinical case of astringent anemia in a sheep coinfected with Mycoplasma ovis and "Candidatus Mycoplasma haemovis" in Hokkaido, Japan. J Vet Med Sci 74:99–102. doi:ten.1292/jvms.11-0296. [PubMed] [CrossRef] [Google Scholar]
64. de Bortoli CP, Andre MR, Seki MC, Pinto AA, Machado SDTZ, Machado RZ. 2012. Detection of Hemoplasma and Bartonella species and co-infection with retroviruses in cats subjected to a spaying/neutering program in Jaboticabal, SP, Brazil. Rev Bras Parasitol Vet 21:219–223. doi:10.1590/S1984-29612012000300008. [PubMed] [CrossRef] [Google Scholar]
65. Hirsch BT, Prange S, Hauver SA, Gehrt SD. 2013. Raccoon social networks and the potential for disease manual. PLoS Ane viii:e75830. doi:x.1371/journal.pone.0075830. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
66. Valle SDF, Messick JB, Dos Santos AP, Kreutz LC, Duda NC, Machado Thou, Corbellini LG, Biondo AW, Gonzalez FH. 2014. Identification, occurrence and clinical findings of canine hemoplasmas in southern Brazil. Comp Immunol Microbiol Infect Dis 37:259–265. doi:ten.1016/j.cimid.2014.08.001. [PubMed] [CrossRef] [Google Scholar]
67. Willi B, Boretti FS, Baumgartner C, Tasker Southward, Wenger B, Cattori V, Meli ML, Reusch CE, Lutz H, Hofmann-Lehmann R. 2006. Prevalence, take chances gene analysis, and follow-up of infections caused by 3 feline hemoplasma species in cats in Switzerland. J Clin Microbiol 44:961–969. doi:10.1128/JCM.44.iii.961-969.2006. [PMC complimentary article] [PubMed] [CrossRef] [Google Scholar]
68. Grazziotin AL, Santos AP, Guimaraes AM, Mohamed A, Cubas ZS, de Oliveira MJ, dos Santos LC, de Moraes W, Vieira RF, Donatti L, de Barros Filho IR, Biondo AW, Messick JB. 2011. Mycoplasma ovis in captive cervids: prevalence, molecular label and phylogeny. Vet Microbiol 152:415–419. doi:ten.1016/j.vetmic.2011.05.001. [PubMed] [CrossRef] [Google Scholar]
69. Schoettle HT. A naturalist's guide to St. Simons Island. Watermarks Publisher, Darien, GA. [Google Scholar]
70. Thomas DH. 1978. The anthropology of St. Catherines Island. American Museum of Natural History, New York, NY. [Google Scholar]
71. Hwang J, Gottdenker NL. 2013. Bartonella species in raccoons and feral cats, Georgia, USA. Emerg Infect Dis nineteen:1167–1168. doi:x.3201/eid1907.130010. [PMC gratuitous article] [PubMed] [CrossRef] [Google Scholar]
72. Christen R. 2008. Identifications of pathogens–a bioinformatic bespeak of view. Curr Opin Biotechnol 19:266–273. doi:10.1016/j.copbio.2008.04.003. [PubMed] [CrossRef] [Google Scholar]
73. Barker EN, Langton DA, Helps CR, Brown Grand, Malik R, Shaw SE, Tasker S. 2012. Haemoparasites of free-roaming dogs associated with several remote Ancient communities in Commonwealth of australia. BMC Vet Res 8:55. doi:10.1186/1746-6148-8-55. [PMC complimentary commodity] [PubMed] [CrossRef] [Google Scholar]
74. Raimundo JM, Guimaraes A, Botelho CF, Peixoto MP, Pires MS, Machado CH, Santos HA, Massard CL, Andre MR, Machado RZ, Baldani CD. 2016. Hematological changes associated with hemoplasma infection in cats in Rio de Janeiro, Brazil. Rev Bras Parasitol Vet 25:441–449. doi:10.1590/s1984-29612016086. [PubMed] [CrossRef] [Google Scholar]
75. Abd Rani PA, Irwin PJ, Coleman GT, Gatne M, Traub RJ. 2011. A survey of canine tick-borne diseases in Republic of india. Parasit Vectors 4:141. doi:10.1186/1756-3305-4-141. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
76. Volokhov DV, Kong H, George J, Anderson C, Chizhikov VE. 2008. Biological enrichment of Mycoplasma agents by cocultivation with permissive cell cultures. Appl Environ Microbiol 74:5383–5391. doi:ten.1128/AEM.00720-08. [PMC costless commodity] [PubMed] [CrossRef] [Google Scholar]
77. Ashelford KE, Chuzhanova NA, Fry JC, Jones AJ, Weightman AJ. 2006. New screening software shows that virtually recent large 16S rRNA gene clone libraries contain chimeras. Appl Environ Microbiol 72:5734–5741. doi:10.1128/AEM.00556-06. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
78. Hugenholtz P, Huber T. 2003. Chimeric 16S rDNA sequences of diverse origin are accumulating in the public databases. Int J Syst Evol Microbiol 53:289–293. doi:x.1099/ijs.0.02441-0. [PubMed] [CrossRef] [Google Scholar]
79. Wright ES, Yilmaz LS, Noguera DR. 2012. DECIPHER, a search-based approach to chimera identification for 16S rRNA sequences. Appl Environ Microbiol 78:717–725. doi:ten.1128/AEM.06516-11. [PMC free commodity] [PubMed] [CrossRef] [Google Scholar]
eighty. Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R. 2011. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 27:2194–2200. doi:10.1093/bioinformatics/btr381. [PMC free commodity] [PubMed] [CrossRef] [Google Scholar]
81. R Evolution Core Team. 2010. R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. [Google Scholar]
82. Crawley MJ. 2013. The R volume, second ed John Wiley and Sons, Ltd., New York, NY. [Google Scholar]
83. Griffith DM, Veech JA, Marsh CJ. 2016. cooccur: probabilistic species co-occurrence analysis in R. J Stat Softw 69:17. [Google Scholar]
Manufactures from Practical and Environmental Microbiology are provided hither courtesy of American Society for Microbiology (ASM)
Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5394313/
0 Response to "How to Upload Dv Sessions to Proycon"
Postar um comentário